View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_high_36 (Length: 328)
Name: NF1169_high_36
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 321
Target Start/End: Complemental strand, 49751755 - 49751435
Alignment:
| Q |
1 |
ttcggtatcacattccgatgagttcgatttcagtgaattcgatatccattccgctctaaaagaggtagtgctcttgaattttggtttgttttgaatcatt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
49751755 |
ttcggtatcacattccgatgagttcaatttcagtgaattcgatatccattccgctctaaaagaggtagtgctcttgaattttggtttgttttgaattatt |
49751656 |
T |
 |
| Q |
101 |
gagctgaaagtagttatgaatttggtgtttaattgttttgtgattaggtttttggagagttagggtttgggattgttgaaagaggagagtggaagtttca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49751655 |
gagctgaaagtagttatgaatttggtgtttaattgttttgtgattaggtttttggagagttagggtttgggattgttgaaagaggagagtggaagtttca |
49751556 |
T |
 |
| Q |
201 |
taagtatgtaaaggaacctgcgtttggacctggtttacctgttaacactgttttcattgctgggaagcttgtagatgatgagatcaaggacttttcaggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49751555 |
taagtatgtaaaggaacctgcgtttggacctggtttacctgttaacactgttttcattgctgggaagcttgtagatgatgagatcaaggacttttcaggt |
49751456 |
T |
 |
| Q |
301 |
ttctcaagtttatattattgg |
321 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
49751455 |
ttctcaagtttatattgttgg |
49751435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University