View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_high_38 (Length: 302)
Name: NF1169_high_38
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_high_38 |
 |  |
|
| [»] scaffold0037 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 82 - 245
Target Start/End: Complemental strand, 25977067 - 25976904
Alignment:
| Q |
82 |
gcattattgattgtcctattcttttgcaaatctagattagcttggtttatactctctaggtattttatattttcattctgttgcggcagttttttgttct |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25977067 |
gcattattgattgtcctattcttttgcaaatctagattagcttggtttatactctctaggtattttatattttcattctgttgcggcagttttttgttct |
25976968 |
T |
 |
| Q |
182 |
ttaaatgttaacggatctttcatcatttcacagaaaataaaccaaatacaccctacctatgata |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25976967 |
ttaaatgttaacggatctttcatcatttcacagaaaataaaccaaatacaccctacctatgata |
25976904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0037 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0037
Description:
Target: scaffold0037; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 6 - 87
Target Start/End: Complemental strand, 32572 - 32490
Alignment:
| Q |
6 |
ctactgagctcgacctctatttacctgttgggtaannnnnnnn-agttttctgttacacagggagaatggaatgtaagcatta |
87 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32572 |
ctactgagctcggcctctatttacctgttgggtaatttttttttagttttctgttacacagggagaatggaaagtaagcatta |
32490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0037; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 6 - 87
Target Start/End: Original strand, 102975 - 103059
Alignment:
| Q |
6 |
ctactgagctcgacctctatttacctgttgggtaannnnnnnn---agttttctgttacacagggagaatggaatgtaagcatta |
87 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
102975 |
ctactgagctcggcctctatttacctgttgggtaatttttttttttagttttctgttacacagggagaatggaaagtaagcatta |
103059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University