View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_high_42 (Length: 288)
Name: NF1169_high_42
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_high_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 48 - 272
Target Start/End: Original strand, 3810930 - 3811154
Alignment:
| Q |
48 |
aagcttgcatgcaatccttctattaatctaaatggcagcagaaactctccctcacttcacttttctctccaactgaaccataaaacccatttttcccgaa |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810930 |
aagcttgcatgcaatccttctattaatctaaatggcagcagaaactctccctcacttcacttttctctccaactgaaccataaaacccatttttcccgaa |
3811029 |
T |
|
| Q |
148 |
attcaactttctctaaatttatgcgatgagtagcttgttagtgatgattctacgctgccacggatctaaggtaagtgaaagtaagttgtttcccctcctt |
247 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811030 |
attcaactttctctaaatttatacgatgagtagcttgttagtgatgattctacgctgccaaggatctaaggtaagtgaaagtaagttgtttcccctcctt |
3811129 |
T |
|
| Q |
248 |
tccatcgctcaaaacctaacctttg |
272 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3811130 |
tccatcgctcaaaacctaacctttg |
3811154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University