View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_high_43 (Length: 278)
Name: NF1169_high_43
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 61 - 157
Target Start/End: Complemental strand, 27879377 - 27879281
Alignment:
| Q |
61 |
catgtaagaattgaccagcatcatctttaaaacaaagacctactgccataatggatgatgctagcgtagcaagtctgtaataaactatgattgtcta |
157 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27879377 |
catgtaagaattgaccagcatcatctctaaaacaaagacctactgccataatggatgatgctagcgtagcaagtctgtaataaactatgattgtcta |
27879281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University