View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_high_45 (Length: 262)
Name: NF1169_high_45
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_high_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 181
Target Start/End: Original strand, 39120586 - 39120766
Alignment:
| Q |
1 |
tgggaggtatatgcagtcatgctggctgataaaattgatgggtaccgaaaacaggaaaagcgcttgatttctgaattcaataagcattttaatgttgagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39120586 |
tgggaggtatatgcagtcatgctggctgataaaattgatgggtaccgaaaacaggaaaagcgcttgatttctgaattcaataagcattttaatgttgagt |
39120685 |
T |
 |
| Q |
101 |
tcattgaccacgatgtaaacaaagatgatgggattgtgcactgggtggaacgtgaccatccaagaaagtaagatgttaaag |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39120686 |
tcattgaccacgatgtaaacaaagatgatgggattgtgcactgggtggaacgtgaccatccaagaaagtaagatgttaaag |
39120766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University