View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_high_49 (Length: 258)
Name: NF1169_high_49
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_high_49 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 33 - 258
Target Start/End: Original strand, 6996446 - 6996671
Alignment:
| Q |
33 |
ttcgcctcttctcctcaccggctgccggagaccgagacccgcgacggtggtcacacgtgctggcgcaagtacaagtagctatgctttcgcgattgctctt |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
6996446 |
ttcgcctcttctcctcaccggctgccggagaccgagacccgcgacggtggtcacacgtgctggcgcaagtacaagtagctatgccttcgcgattgcgctt |
6996545 |
T |
|
| Q |
133 |
cctctttctctcctcggtataactgttttcactgctcttcggattggtcagaagcttgaccaagatttctacgaagaggtaatgccacaaactaatgttg |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6996546 |
cctctttctctcctcggtataactgttttcactgctcttcggattggtcagaagcttgaccaagatttctatgaagaggtaatgccacaaactaatgttg |
6996645 |
T |
|
| Q |
233 |
ggtttttctcagtaatgtgatccttt |
258 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
6996646 |
agtttttctcagtaatgtgattcttt |
6996671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University