View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_high_51 (Length: 254)
Name: NF1169_high_51
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_high_51 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 78 - 254
Target Start/End: Complemental strand, 26846191 - 26846015
Alignment:
| Q |
78 |
agcagagaccttgttggcatagtggatattgcgatcacattgattgcagagagctgcttcatctgcagggcaaaacaaggaggcctcttgtttgtgacat |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26846191 |
agcagagaccttgttggcatagtggatattgcgatcacattgattgcagagagctgcttcatctgcagggcaaaacaaggaggcctcttgtttgtgacat |
26846092 |
T |
 |
| Q |
178 |
gcatcacactggatcttcatctccttacttttgagcgttttggagatttgggttttgttttgaaggcaaagtgggga |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26846091 |
gcatcacactggatcttcatctccttacttttgagcgttttggagatttgggttttgttttgaaggcaaagtgggga |
26846015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University