View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_high_55 (Length: 251)
Name: NF1169_high_55
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_high_55 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 148 - 238
Target Start/End: Original strand, 11361191 - 11361281
Alignment:
| Q |
148 |
attagcattagaatgttagcaaccaaaaataaacataaatattataatgttagtaaccaaaagtaaatattaaaattttgatgtaattctt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11361191 |
attagcattagaatgttagcaaccaaaaatatacataaatattagaatgttagtaaccaaaagtaaatattaaaattttcatgtaattctt |
11361281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 10 - 107
Target Start/End: Original strand, 11361045 - 11361150
Alignment:
| Q |
10 |
aagaatatttataccaacatcagcttgagtaattttttgcatc--------cctcagttctacaaccagtcttctctgacacaacagaaaagaaaatata |
101 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11361045 |
aagaatatttgtaccaacatcagcttgagtaattttttgcatcaagagagacctcagttctacaaccagtcttctctgacacaacagaaaagaaaatatc |
11361144 |
T |
 |
| Q |
102 |
ttcaag |
107 |
Q |
| |
|
|||||| |
|
|
| T |
11361145 |
ttcaag |
11361150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University