View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_high_61 (Length: 243)
Name: NF1169_high_61
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_high_61 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 22 - 243
Target Start/End: Original strand, 35189996 - 35190217
Alignment:
| Q |
22 |
aattcaaactaaccgttgatgttatcttgttagttcacttaagaatcattgagtgaatccatctaattataaaaattcttcatggattttatccaaatag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35189996 |
aattcaaactaaccgttgatgttatcttgttagttcacttaagaatcattgagttaatccatctaattataaaaattcttcatggattttatccaaatag |
35190095 |
T |
|
| Q |
122 |
ttgcttcaattttttctcagttactgtgccctctgcttctcattagaagattggaatgttttgcatctgaaaatgtgttatcgaagttggtattgtttgc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
35190096 |
ttgcttcaattttttctcagttactgtgccctctgcttctcattagaagattggaatgttttgcatctgaaaatgtgttatccaagttggtgttgtttgc |
35190195 |
T |
|
| Q |
222 |
cctggtttgggctaatcagctt |
243 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35190196 |
cctggtttgggctaatcagctt |
35190217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University