View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_high_62 (Length: 242)
Name: NF1169_high_62
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_high_62 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 242
Target Start/End: Complemental strand, 26846246 - 26846015
Alignment:
| Q |
11 |
cacagagaggagtgtctttggaagtggggtggtgaagagtgaagcgtttgtgtttagcagagaccttgttggcatagtggatattgcgatcacattgatt |
110 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26846246 |
cacagagaggggtgtctttggaagtggggtggtgaagagtgaagcgtttgtgtttagcagagaccttgttggcatagtggatattgcgatcacattgatt |
26846147 |
T |
|
| Q |
111 |
gcagagagctgcttcatctgcagggcaaaacaaggaggcctcttgtttgtgacatgcatcacactggatcttcatctccttacttttgagcgttttggag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26846146 |
gcagagagctgcttcatctgcagggcaaaacaaggaggcctcttgtttgtgacatgcatcacactggatcttcatctccttacttttgagcgttttggag |
26846047 |
T |
|
| Q |
211 |
atttgggttttgttttgaaggcaaagtgggga |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26846046 |
atttgggttttgttttgaaggcaaagtgggga |
26846015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University