View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_high_66 (Length: 221)
Name: NF1169_high_66
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_high_66 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 9 - 122
Target Start/End: Original strand, 49733911 - 49734024
Alignment:
| Q |
9 |
agcataggtaccactcttgttgagcaacgtttcatgctttcctttctcttcaatcactccatttttaaccactgcaattgaatttgaaccctttatggta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49733911 |
agcataggtaccactcttgttgagcaacgtttcatgctttcctttctcttcaatcactccatttttaaccactgcaattgaatttgaaccctttatggta |
49734010 |
T |
|
| Q |
109 |
gatagtctatgagc |
122 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
49734011 |
gatagtctatgagc |
49734024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 101
Target Start/End: Complemental strand, 36289245 - 36289169
Alignment:
| Q |
25 |
ttgttgagcaacgtttcatgctttcctttctcttcaatcactccatttttaaccactgcaattgaatttgaaccctt |
101 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||| ||| || ||||| || |||||||||||| ||| || |||||| |
|
|
| T |
36289245 |
ttgttgatcaatgtttcatgatttcctttctctgtaatgaccccattcttcaccactgcaattaaatctgcaccctt |
36289169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 124 - 201
Target Start/End: Complemental strand, 47357817 - 47357740
Alignment:
| Q |
124 |
gcaccacagaagcaccgatgaaactccaattatatttgtgtagatcacgttagttaaactttagtttgtcgtgtatgt |
201 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47357817 |
gcaccaaagaagcaccgatgaaactccaattatatttgtgtagatcacgttagttaaactttagtttgtcgtgtatgt |
47357740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 9 - 122
Target Start/End: Complemental strand, 51216591 - 51216478
Alignment:
| Q |
9 |
agcataggtaccactcttgttgagcaacgtttcatgctttcctttctcttcaatcactccatttttaaccactgcaattgaatttgaaccctttatggta |
108 |
Q |
| |
|
||||||||| |||| |||||||| ||| | ||||| |||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| || |
|
|
| T |
51216591 |
agcataggtgccacccttgttgatcaatatgtcatgttttcctttctcttcaatcactccatttttaacaactgcaattgaatttgcaccctttattgtt |
51216492 |
T |
|
| Q |
109 |
gatagtctatgagc |
122 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
51216491 |
gataatctatgagc |
51216478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University