View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1169_high_69 (Length: 214)

Name: NF1169_high_69
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1169_high_69
NF1169_high_69
[»] chr8 (1 HSPs)
chr8 (1-81)||(42839471-42839551)


Alignment Details
Target: chr8 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 42839471 - 42839551
Alignment:
1 gagttgtagaggttggagttgatcaaggaggagagtttggtcttgataagttatctaagtttaggttctgaggcttggcat 81  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42839471 gagttgtagaggttggagttgatcgaggaggagagtttggtcttgataagttatctaagtttaggttctgaggcttggcat 42839551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University