View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_high_70 (Length: 202)
Name: NF1169_high_70
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_high_70 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 10209827 - 10209660
Alignment:
| Q |
1 |
ccaaacctgaaccactcatgatagccaccatccttcgttctctcccttctctccatcaaaccctactctctctcatgacttcccaccatctttctgctct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
10209827 |
ccaaacctgaaccactcatgatagccaccatccttcgttctctcccttctctccatcaaaccctactctctctcatgacttcccaccgtctctctgctct |
10209728 |
T |
 |
| Q |
101 |
cattatcgacctatttggtaccgatgcctttgacatggccgctgaactagatatcccttcgtatctct |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10209727 |
cattatcgacctatttggtaccgatgcctttgacatggccgctgaactagatatcccttcgtatctct |
10209660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 1 - 168
Target Start/End: Complemental strand, 10202754 - 10202587
Alignment:
| Q |
1 |
ccaaacctgaaccactcatgatagccaccatccttcgttctctcccttctctccatcaaaccctactctctctcatgacttcccaccatctttctgctct |
100 |
Q |
| |
|
||||||| ||| ||||||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
10202754 |
ccaaacccgaaacactcatgacagccaccaccgttcgctctctcccttctctccatcaaaccctactctctctcatgacttcccaccgtctctctgctct |
10202655 |
T |
 |
| Q |
101 |
cattatcgacctatttggtaccgatgcctttgacatggccgctgaactagatatcccttcgtatctct |
168 |
Q |
| |
|
|||| |||||||||| || || |||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10202654 |
cattgtcgacctattcggcactgatgtctttgacatggccgctgaactagatatcccttcatatctct |
10202587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University