View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_12 (Length: 501)
Name: NF1169_low_12
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 5e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 5e-94
Query Start/End: Original strand, 222 - 396
Target Start/End: Original strand, 14578925 - 14579099
Alignment:
| Q |
222 |
attatagatctagtataaaacgcaagtcagcttcttgattgaactttgtgaaaactacggttcaaatcaattatatttatatacttgcgaatatcaattt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14578925 |
attatagatctagtataaaacgcaagtcagcttcttgattgaactttgtgaaaactacggttcaaatcaattatatttatatacttgcgaatatcaattt |
14579024 |
T |
|
| Q |
322 |
atttgcaggctcactcgtctgattttgattttttcatgatatttcagaccctttagtactgcaacatcttttcta |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14579025 |
atttgcaggctcactcgtctgattttgattttttcatgatatttcagaccctttagtactgcaacatcttttcta |
14579099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University