View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1169_low_15 (Length: 463)

Name: NF1169_low_15
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1169_low_15
NF1169_low_15
[»] chr4 (2 HSPs)
chr4 (358-455)||(22182740-22182837)
chr4 (358-423)||(22165518-22165585)
[»] chr8 (1 HSPs)
chr8 (306-360)||(8270765-8270819)


Alignment Details
Target: chr4 (Bit Score: 90; Significance: 3e-43; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 358 - 455
Target Start/End: Original strand, 22182740 - 22182837
Alignment:
358 ggtgtgataggctaaccgtgttgggttagggcgttatgggtgtcacttttgttttgcggaacttagtgtttggctgggactatctaggttcctatgct 455  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
22182740 ggtgtgataggctaaccgtgttgggttagcgcgttatgggtgtcacttttgttttgcggaacttagtgtttggctgggactatctaggttcctgtgct 22182837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 358 - 423
Target Start/End: Original strand, 22165518 - 22165585
Alignment:
358 ggtgtgataggctaaccgtgttgggttagggc--gttatgggtgtcacttttgttttgcggaacttag 423  Q
    |||||||||||| ||||||||| |||||||||  ||||||||||||||||||||||||||||||||||    
22165518 ggtgtgataggcgaaccgtgtttggttagggcttgttatgggtgtcacttttgttttgcggaacttag 22165585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 306 - 360
Target Start/End: Complemental strand, 8270819 - 8270765
Alignment:
306 gtagtggtttcaacactcgttctaagctttcttatttgtttcaatgtattttggt 360  Q
    ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||    
8270819 gtagttgtttcaacactcgttataagctttcttatttgtttcaatgtattttggt 8270765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University