View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_30 (Length: 380)
Name: NF1169_low_30
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 7e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 82 - 226
Target Start/End: Original strand, 42234878 - 42235022
Alignment:
| Q |
82 |
atgaaggcaattcctaggtat-ctttctctttatgtgatgtaaccgggtaaattaatcaaaatcaaatcaactagaattatatattgacccgggccagta |
180 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42234878 |
atgaaggcaattcctaggtatactttctctttatgtgatgtaaccgggtaaattaatcaaaatcaaatcaactagaattatatattgacccgggccagta |
42234977 |
T |
 |
| Q |
181 |
aagaaatagcaatgaattgaatgagcaatgtgtgtacaactttggt |
226 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
42234978 |
aagaaatagcaatgaa-tgaacgagcaatgtgtgtacaactttggt |
42235022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 244 - 284
Target Start/End: Original strand, 42235038 - 42235078
Alignment:
| Q |
244 |
gttcttgatatatttcaaagtgagtgatggtaagattcatt |
284 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42235038 |
gttcttgatatatttcaaagtgattgatggtaagattcatt |
42235078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University