View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_35 (Length: 365)
Name: NF1169_low_35
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 79 - 268
Target Start/End: Original strand, 25825721 - 25825910
Alignment:
| Q |
79 |
agcagagacgccgaagttgtgatcatttacacttagaacagaatttgctgaatcaaattctgtggtttgattcgacgagtcttttggaaggtttccggag |
178 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25825721 |
agcagaaacgcccaagttgtgatcatttacacttagaacagaatttgctgaatcaaattctgtggtttgattcgacgagtcttttggaaggtttccggag |
25825820 |
T |
 |
| Q |
179 |
caaagaatcttgcgcatgatggctgtgagacatcctgtagttgtggatttggagctgctacacattggtggagatacatttgaacaagat |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25825821 |
caaagaatcttgcgcatgatggctgtgagacatcctgtagttgtggatttggagctgctacacattggtggagatacatttgaacaagat |
25825910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University