View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_36 (Length: 361)
Name: NF1169_low_36
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 28 - 352
Target Start/End: Original strand, 7430420 - 7430744
Alignment:
| Q |
28 |
cacgtcattcctcgaagcttcgacgcgaactgcgtaatcgcgacattcggaggtaacgaattcgaagaagatggagacgtaaggtttggatgttgcatag |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430420 |
cacgtcattcctcgaagcttcgacgcgaactgcgtaatcgcgacattcggaggtaacgaattcgaagaagatggagacgtaaggtttggatgttgcatag |
7430519 |
T |
|
| Q |
128 |
ggataactctgataggacgagtcggcatggatgcggcggagggaaggtcggagtaactgtgggatgcgaaggttgttggtgttatctccatgcgcatcag |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430520 |
ggataactctgataggacgagtcggcatggatgcggcggagggaaggtcggagtaactgtgggatgcgaaggttgttggtgttatctccatgcgcatcag |
7430619 |
T |
|
| Q |
228 |
tggtggcgcattggttttgatcggaggcgcgtgagaattgagtagcgcgtggtggtggatgaaatatgaatgtgatggttgagatttgaggaagaactgg |
327 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7430620 |
tggtggcgcattggttttaatcggaggcgcgtgagaattgagtagcgcgtggtggtggaggaaatgtgaatgtgatggttgagatttgaggaagaactgg |
7430719 |
T |
|
| Q |
328 |
actgaatgatataacagagtattat |
352 |
Q |
| |
|
|||||||||||||||||| |||||| |
|
|
| T |
7430720 |
actgaatgatataacagaatattat |
7430744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University