View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1169_low_49 (Length: 317)

Name: NF1169_low_49
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1169_low_49
NF1169_low_49
[»] chr3 (1 HSPs)
chr3 (31-220)||(25825721-25825910)


Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 31 - 220
Target Start/End: Original strand, 25825721 - 25825910
Alignment:
31 agcagagacgccgaagttgtgatcatttacacttagaacagaatttgctgaatcaaattctgtggtttgattcgacgagtcttttggaaggtttccggag 130  Q
    |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25825721 agcagaaacgcccaagttgtgatcatttacacttagaacagaatttgctgaatcaaattctgtggtttgattcgacgagtcttttggaaggtttccggag 25825820  T
131 caaagaatcttgcgcatgatggctgtgagacatcctgtagttgtggatttggagctgctacacattggtggagatacatttgaacaagat 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25825821 caaagaatcttgcgcatgatggctgtgagacatcctgtagttgtggatttggagctgctacacattggtggagatacatttgaacaagat 25825910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University