View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_50 (Length: 317)
Name: NF1169_low_50
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 84 - 223
Target Start/End: Complemental strand, 42694313 - 42694174
Alignment:
| Q |
84 |
gaacgggcagaaaaccaaatccgaaaggtactaacacattcagtaatgttttatcatcttaccatatcatttaataatttggtacttggaatttgcatca |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42694313 |
gaacgggcagaaaaccaaatccgaaaggtactaacacattcagtaatgttttatcatcttaccatatcatttaataatttggtacttggaatttgcatca |
42694214 |
T |
 |
| Q |
184 |
aactttatgaaatcaagaatgttaatgtgttgataatatt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42694213 |
aactttatgaaatcaagaatgttaatgtgttgataatatt |
42694174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University