View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_53 (Length: 297)
Name: NF1169_low_53
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_53 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 15 - 297
Target Start/End: Original strand, 39268634 - 39268928
Alignment:
| Q |
15 |
agccctagctgttgcttcatttagactttgttgtcgattataatagcattttatttcatgtgtcagttgaaagtgatgtatt------------gtctgg |
102 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39268634 |
agcccaagctgttgattcatttagactttgttgtcgattataatagcattttatttcatgtgtcagttgaaagtgatgtattagtactgaaaatgtctgg |
39268733 |
T |
 |
| Q |
103 |
gcagagtgtattttggttaaggtttctagaggaaatttcagaaaaatttgtctgggcagtgtgtattttggtgaaggattctagaagaaatttttagatg |
202 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39268734 |
gcagagtgtattttgtttaaggtttctagaggaaatttctgaaaaatttgtctgggcagtgtgtattttggtgaaggattctagaggaaatttttagatg |
39268833 |
T |
 |
| Q |
203 |
caacatgatcatatcaaggctcattgattcttgtttgaagtatgatgattgacttgagtctacacgcatttatgcataacatttttgttgacttt |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39268834 |
caacatgatcatatcaaggctcattgattcttgtttgaagtatgatgattgacttgagtctacacgcatttatgcataacatttttgttgacttt |
39268928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University