View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_56 (Length: 278)
Name: NF1169_low_56
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 33 - 245
Target Start/End: Complemental strand, 166277 - 166065
Alignment:
| Q |
33 |
tgtcgaaaaatattacttcaccaatataagttgcatcatgttttctattaaattttttgcctttaaaacacaaatcgtaaacaccgattttccttcatca |
132 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
166277 |
tgtcaaaaaatattacttcaccaatataagttgcatcatgttttctattaaattttttgcctttaaaacacaaatcgtaaacaccgattttccttcatca |
166178 |
T |
|
| Q |
133 |
tgccaaaaataacaacagcttctctaaatttacaatcgtttatataggttctcaattcttctaatcaattgaaagcacacctgtcagaatctgtttctag |
232 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
166177 |
tgccaaaaataacaacagtttctctaaatttacaatcgtttatataggttctcaattcttctaatcaattaaaagcacacctgtcagaatctgtttctag |
166078 |
T |
|
| Q |
233 |
gatattgttggag |
245 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
166077 |
gatattgctggag |
166065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University