View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_58 (Length: 272)
Name: NF1169_low_58
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_58 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 90 - 224
Target Start/End: Complemental strand, 44559944 - 44559810
Alignment:
| Q |
90 |
gagatgaacgagggtaaggttatcttgtggtgcagtgttttgaagggaaaatatagccgagggatacttgaggagaggcattgttgctaaaccctcagat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44559944 |
gagatgaacgagggtaaggttatcttgtggtgcagtgttttgaagggaaaatatagccgagggatacttgaggagaggcattgttgctaaaccctcagat |
44559845 |
T |
|
| Q |
190 |
tatttatttgcaaagtaatggttagcacttggact |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44559844 |
tatttatttgcaaagtaatggttagcacttggact |
44559810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University