View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_62 (Length: 261)
Name: NF1169_low_62
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_62 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 66 - 241
Target Start/End: Original strand, 48845377 - 48845554
Alignment:
| Q |
66 |
tttgaaaaatatatcattgaaatcatatgcatgtaaccggacagcctccatcttgcaaactagtacccggatatatatgaggttgtatttaaatgttaat |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48845377 |
tttgaaaaatatatcattgaaatcatatgcatgtaaccggacagcctccatcttgcaacctagtacccggatatatatgaggttgtatttaaatgttaat |
48845476 |
T |
 |
| Q |
166 |
tattgaattaacggnnnnnnnaatgattattagaaactc--agacagtatgcacgttgttattgtcaatcatgatatt |
241 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48845477 |
tattgaattaacggtttttttaatgattatcagaaactcatagagagtatgcacgttgttattgtcaatcatgatatt |
48845554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 66 - 173
Target Start/End: Complemental strand, 7017464 - 7017356
Alignment:
| Q |
66 |
tttgaaaaatatatcattgaaatcatatgcatgtaa-ccggacagcctccatcttgcaaactagtacccggatatatatgaggttgtatttaaatgttaa |
164 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7017464 |
tttgaaaagtatatcattgaaatcatatgcatgtaaaccggacagcctccatcttgcaacctagtacccagatatatatgaggttgtatttaaatgttaa |
7017365 |
T |
 |
| Q |
165 |
ttattgaat |
173 |
Q |
| |
|
||||||||| |
|
|
| T |
7017364 |
ttattgaat |
7017356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 187 - 241
Target Start/End: Complemental strand, 7017047 - 7016991
Alignment:
| Q |
187 |
aatgattattagaaactca--gacagtatgcacgttgttattgtcaatcatgatatt |
241 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| |||||||| |
|
|
| T |
7017047 |
aatgattattagaaactcatagatagtatgcacgttgttattgtcaattatgatatt |
7016991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University