View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_63 (Length: 260)
Name: NF1169_low_63
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_63 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 7e-95; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 30 - 260
Target Start/End: Complemental strand, 39269146 - 39268914
Alignment:
| Q |
30 |
atttggtcccttaaacatttggtccagggtttgatccatgaccagcgtgtaggaaaaacatttgttgggagaagtcaacccttaaaatggatccctctac |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39269146 |
atttggtcccttaaacatttggtccagggtttgatccatgaccagtgtgtaggaaaaacatttgttgggagaagtcaacccttaaaatggatccctctac |
39269047 |
T |
|
| Q |
130 |
cctctagggattagttcaatgcagaagataccttggtttaccnnnnnnnnnnnnnntaaatccccaatcctagaaaggtaatagta--ataccttgtgaa |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39269046 |
cctctagggattagttcaatgcagaagataccttggtttaccaaaaaagaaaaaaataaatccccaatcctagaaaggtaatagtaatataccttgtgaa |
39268947 |
T |
|
| Q |
228 |
aacggaaaagtaagatgcaaagtcaacaaaaat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39268946 |
aacggaaaagtaagatgcaaagtcaacaaaaat |
39268914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 42 - 122
Target Start/End: Complemental strand, 34338104 - 34338023
Alignment:
| Q |
42 |
aaacatttggtccagggtttgatccatgaccagcgtgta-ggaaaaacatttgttgggagaagtcaacccttaaaatggatc |
122 |
Q |
| |
|
|||| ||||||| |||||||||||| ||| | | ||||| ||||||||||||||||||| | |||||||| | ||||||||| |
|
|
| T |
34338104 |
aaacttttggtctagggtttgatccttgatcggtgtgtatggaaaaacatttgttgggataggtcaaccccttaaatggatc |
34338023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 34 - 122
Target Start/End: Original strand, 41538966 - 41539055
Alignment:
| Q |
34 |
ggtcccttaaacatttggtccagggtttgatccatgaccagcgtgtagg-aaaaacatttgttgggagaagtcaacccttaaaatggatc |
122 |
Q |
| |
|
|||| ||||| |||| ||||||||||| ||||| || || | | ||||| ||||| |||||||||||||||||||||| | ||||||||| |
|
|
| T |
41538966 |
ggtctcttaaccattcggtccagggttcgatccctggccggtgcgtagggaaaaatatttgttgggagaagtcaaccccttaaatggatc |
41539055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University