View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_65 (Length: 258)
Name: NF1169_low_65
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_65 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 30 - 258
Target Start/End: Original strand, 37831716 - 37831944
Alignment:
| Q |
30 |
gtaagcacacttgaattcacttcaaattttatatatagacgcaattgtgaagttaagatcatttttatagacatagcattgggaagcatgattaaagggg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37831716 |
gtaagcacacttgaattcacttcaaattttatatatagacgcaattgtgaagttaagatcatttttatagacatagcattgggaagcatgattaaagggg |
37831815 |
T |
 |
| Q |
130 |
tttgaagtgtgatgattcacttgtttctctatgtccttcaggcaaacctaagttagaaaaaattgaatcaagctaaccatatgatagcagttacttcaca |
229 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37831816 |
tttgaagtgtgatgattcaattgtttctctatgtccttcaggcaaacctaagttagaaaaaattgaatcaagctaaccatatgacagcagttacttcaca |
37831915 |
T |
 |
| Q |
230 |
cattaaccgacaagcagattgttaatgct |
258 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37831916 |
cattaaccgacaagcagattgttaatgct |
37831944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University