View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1169_low_66 (Length: 254)

Name: NF1169_low_66
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1169_low_66
NF1169_low_66
[»] chr4 (1 HSPs)
chr4 (78-254)||(26846015-26846191)


Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 78 - 254
Target Start/End: Complemental strand, 26846191 - 26846015
Alignment:
78 agcagagaccttgttggcatagtggatattgcgatcacattgattgcagagagctgcttcatctgcagggcaaaacaaggaggcctcttgtttgtgacat 177  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26846191 agcagagaccttgttggcatagtggatattgcgatcacattgattgcagagagctgcttcatctgcagggcaaaacaaggaggcctcttgtttgtgacat 26846092  T
178 gcatcacactggatcttcatctccttacttttgagcgttttggagatttgggttttgttttgaaggcaaagtgggga 254  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26846091 gcatcacactggatcttcatctccttacttttgagcgttttggagatttgggttttgttttgaaggcaaagtgggga 26846015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University