View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_67 (Length: 252)
Name: NF1169_low_67
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_67 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42983763 - 42983535
Alignment:
| Q |
1 |
tggacattagagtttgcttcccccaacggctaagattgatcaaacaatgatttggatacattttccggtattgaatgtgttttattataacaacgtgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42983763 |
tggacattagagtttgcttcccccaacggctaagattgatcaaacaatgatttggatacattttccggtattgaatgtgttttattataacaacgtctga |
42983664 |
T |
 |
| Q |
101 |
ataggaagatttgattgggtttgtatccaaattgatatgaacaaacctattatagaaaaggtgtgaatgagaaatcattggt------atcaggtggaat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42983663 |
ataggaagatttgattgggtttgtatccaaattgatatgaacaaacctattatagaaaaggtgtgaatgagaaatcattggtatcactatcaggtggaat |
42983564 |
T |
 |
| Q |
195 |
atgagggcctctgttgtgtatgttctact |
223 |
Q |
| |
|
||||||||||| ||||||||||||||||| |
|
|
| T |
42983563 |
atgagggcctccgttgtgtatgttctact |
42983535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University