View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_70 (Length: 251)
Name: NF1169_low_70
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_70 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 16 - 251
Target Start/End: Original strand, 1651380 - 1651616
Alignment:
| Q |
16 |
atacccattttgatagtttaacttgatttgtgattttctgcaatttggggtttctgatttgggaattaataggtgttgtaaccttgtgctcctttttatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1651380 |
atacccattttgatagtttaacttgatttgtgattttctgcaatttggggtttctgatttgggaattaataggtgttgtaaccttgtgctcctttttatg |
1651479 |
T |
 |
| Q |
116 |
tgattgttatgagataaattttctatctttgttgcaccttgattttgtgc-tttagctaatgaatagattggttgtattttaactaagtgattgagctca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1651480 |
tgattgttatgagataaattttctatctttgttgcaccttgattttgtgcttttagctaatgaatagattggttgtattttaactaagtgattgagctca |
1651579 |
T |
 |
| Q |
215 |
aatgattaacgagctcgacaaatcatttaggaaaacc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1651580 |
aatgattaacgagctcgacaaatcatttaggaaaacc |
1651616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University