View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_74 (Length: 246)
Name: NF1169_low_74
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_74 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 47 - 212
Target Start/End: Original strand, 11733397 - 11733554
Alignment:
| Q |
47 |
ggggttgcgttatttggattgataaagcgagtagtgttaaaaagtttagtttgtttcaattgggtctatgatggggtttggtaattcaaaatttcaaatt |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11733397 |
ggggttgcgttatttggattgataaagcgagtagtgttaaaaagtttagtttttttcaattgggtctatgatggggtttggtaa--------ttcaaatt |
11733488 |
T |
|
| Q |
147 |
gcattaagttatgtagttaatagaaaaatcttctggtggttgctcactatgtgtttgtgtttgtgt |
212 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
11733489 |
gcattgagttatgtagttaatagaaaaatctgctgggggttgctcactatgtgtttgtgtttgtgt |
11733554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 186 - 223
Target Start/End: Original strand, 11733329 - 11733366
Alignment:
| Q |
186 |
ttgctcactatgtgtttgtgtttgtgtctttgtgatgt |
223 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
11733329 |
ttgctcactatgtgtttgtgtttatgtctctgtgatgt |
11733366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University