View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_75 (Length: 246)
Name: NF1169_low_75
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 144 - 210
Target Start/End: Complemental strand, 43574826 - 43574760
Alignment:
| Q |
144 |
aatttggattaccttaaattaatgtgtgcaggaatcaacaatcggagcggcatttttcacacaggtt |
210 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43574826 |
aatttgaattaccttaaatgaatgtgtgcaggaatcaacaatcggagccgcatttttcacacaggtt |
43574760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University