View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_low_82 (Length: 230)
Name: NF1169_low_82
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_low_82 |
 |  |
|
| [»] chr1 (4 HSPs) |
 |  |
|
| [»] scaffold0623 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0171 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 7 - 230
Target Start/End: Complemental strand, 14928723 - 14928499
Alignment:
| Q |
7 |
tcatcatctacaaatcacaaaataattagttagaacttagagataaatttcacannnnnnnngtcacaatcttatccttaaatttgtttctgttttcaat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14928723 |
tcatcatctacaaatcacaaaataattagttagaacttagagataaatttcacattttttttgtcacaatcttatccttaaatttgtttctgttttcaat |
14928624 |
T |
 |
| Q |
107 |
ttttattgcatattaatagtgcgctattttacattagagcttcgctctagctttaaatgagtc-ccccgcaagtggacgatgggattggttccctcaaat |
205 |
Q |
| |
|
||| ||||||||||||||||| || ||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14928623 |
tttgattgcatattaatagtgtgcaattttacattagagcttcgctctggctttaaatgagtccccccgcaagtggacaatgggattggttccctcaaat |
14928524 |
T |
 |
| Q |
206 |
taatcggtccttagatataaaaatt |
230 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
14928523 |
taatcggtccttagatataaaaatt |
14928499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 142 - 194
Target Start/End: Original strand, 37047095 - 37047147
Alignment:
| Q |
142 |
agagcttcgctctagctttaaatgagtcccccgcaagtggacgatgggattgg |
194 |
Q |
| |
|
||||||| |||||||||||||||| | ||||| |||||||||| ||||||||| |
|
|
| T |
37047095 |
agagctttgctctagctttaaatggggcccccacaagtggacggtgggattgg |
37047147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 150 - 201
Target Start/End: Complemental strand, 12877022 - 12876971
Alignment:
| Q |
150 |
gctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctc |
201 |
Q |
| |
|
|||||||||||||| | | |||||||||||||||| |||||||||| ||||| |
|
|
| T |
12877022 |
gctctagctttaaacggggcccccgcaagtggacggtgggattggtcccctc |
12876971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 213
Target Start/End: Original strand, 30677293 - 30677350
Alignment:
| Q |
156 |
gctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcggt |
213 |
Q |
| |
|
|||||||||| | ||||||||||||| || |||||||||| |||||| |||| ||||| |
|
|
| T |
30677293 |
gctttaaatgggacccccgcaagtgggcggtgggattggtcccctcagattagtcggt |
30677350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 213
Target Start/End: Original strand, 51532900 - 51532963
Alignment:
| Q |
150 |
gctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcggt |
213 |
Q |
| |
|
|||||| ||||||||| | |||||||||||||||| |||||||||| |||||| |||| ||||| |
|
|
| T |
51532900 |
gctctaactttaaatgggacccccgcaagtggacggtgggattggtcccctcagattagtcggt |
51532963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 207
Target Start/End: Complemental strand, 33398554 - 33398497
Alignment:
| Q |
150 |
gctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaatta |
207 |
Q |
| |
|
|||||||||||||| | | ||||||||||||| || |||||||||||||||| ||||| |
|
|
| T |
33398554 |
gctctagctttaaacggggcccccgcaagtgggcggtgggattggttccctcgaatta |
33398497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 141 - 217
Target Start/End: Complemental strand, 40302741 - 40302665
Alignment:
| Q |
141 |
tagagcttcgctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcggtcctt |
217 |
Q |
| |
|
|||| ||| ||||| |||||||||| ||||||||| |||||| ||||||||| ||||||||||| ||||||||| |
|
|
| T |
40302741 |
tagatctttgctctggctttaaatgctccccccgcaattggacggtgggattggacccctcaaattagtcggtcctt |
40302665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 144 - 214
Target Start/End: Complemental strand, 10538218 - 10538148
Alignment:
| Q |
144 |
agcttcgctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcggtc |
214 |
Q |
| |
|
||||| |||||||||||||||| | || ||||||||||| ||||||||| ||||||||||| |||||| |
|
|
| T |
10538218 |
agctttgctctagctttaaatgggacctacgcaagtggacagtgggattggacccctcaaattagtcggtc |
10538148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0623 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0623
Description:
Target: scaffold0623; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 207
Target Start/End: Complemental strand, 1142 - 1085
Alignment:
| Q |
150 |
gctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaatta |
207 |
Q |
| |
|
||||| |||||||||| | |||||||||||||||| |||||||||| ||||| ||||| |
|
|
| T |
1142 |
gctctggctttaaatggggcccccgcaagtggacggtgggattggtcccctcgaatta |
1085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 207
Target Start/End: Complemental strand, 9385 - 9328
Alignment:
| Q |
150 |
gctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaatta |
207 |
Q |
| |
|
||||| |||||||||| | |||||||||||||||| |||||||||| ||||| ||||| |
|
|
| T |
9385 |
gctctggctttaaatggggcccccgcaagtggacggtgggattggtcccctcgaatta |
9328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 217
Target Start/End: Complemental strand, 17149536 - 17149475
Alignment:
| Q |
156 |
gctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcggtcctt |
217 |
Q |
| |
|
|||||||||| | |||||||||||| ||| |||||||||| ||||| ||||| ||||||||| |
|
|
| T |
17149536 |
gctttaaatggggcccccgcaagtgaacggtgggattggtcccctcgaattagtcggtcctt |
17149475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 142 - 217
Target Start/End: Complemental strand, 11514 - 11439
Alignment:
| Q |
142 |
agagcttcgctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcggtcctt |
217 |
Q |
| |
|
||||||| || || |||||||||| | ||||||||||||| |||||||||| | ||||||||||| | ||||||| |
|
|
| T |
11514 |
agagctttgccctggctttaaatggggtccccgcaagtggaagatgggattgatcccctcaaattagttggtcctt |
11439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 142 - 201
Target Start/End: Complemental strand, 19145505 - 19145447
Alignment:
| Q |
142 |
agagcttcgctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctc |
201 |
Q |
| |
|
||||||| ||||| |||||||||| ||||||||||||||| || |||||||||| ||||| |
|
|
| T |
19145505 |
agagctttgctctggctttaaatg-gtcccccgcaagtgggcggtgggattggtcccctc |
19145447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 217
Target Start/End: Original strand, 4603886 - 4603955
Alignment:
| Q |
148 |
tcgctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcggtcctt |
217 |
Q |
| |
|
||||||| |||||||| | | |||| ||||||||||| |||||||||| ||||| |||| ||||||||| |
|
|
| T |
4603886 |
tcgctctggctttaaacggggcccctgcaagtggacggtgggattggtcccctcggattagtcggtcctt |
4603955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 9659397 - 9659352
Alignment:
| Q |
150 |
gctctagctttaaatgagtcccccgcaagtggacgatgggattggt |
195 |
Q |
| |
|
||||| |||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
9659397 |
gctctggctttaaatgggccccccgcaagtggacggtgggattggt |
9659352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 221
Target Start/End: Complemental strand, 31439445 - 31439410
Alignment:
| Q |
186 |
tgggattggttccctcaaattaatcggtccttagat |
221 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31439445 |
tgggatttgttccctcaaattaatcggtccttagat |
31439410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 211
Target Start/End: Original strand, 41314123 - 41314163
Alignment:
| Q |
171 |
cccgcaagtggacgatgggattggttccctcaaattaatcg |
211 |
Q |
| |
|
|||||||||||||| |||||||||| |||||| |||||||| |
|
|
| T |
41314123 |
cccgcaagtggacggtgggattggtcccctcagattaatcg |
41314163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 150 - 207
Target Start/End: Original strand, 42328119 - 42328176
Alignment:
| Q |
150 |
gctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaatta |
207 |
Q |
| |
|
||||| |||||||| | | ||||| ||||||||||||||||||||| ||||| ||||| |
|
|
| T |
42328119 |
gctctggctttaaacggggcccccacaagtggacgatgggattggtcccctcgaatta |
42328176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 211
Target Start/End: Complemental strand, 43817838 - 43817774
Alignment:
| Q |
147 |
ttcgctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcg |
211 |
Q |
| |
|
||||||||||||||||| | ||||||||||||| || ||| |||||| |||||||||||||| |
|
|
| T |
43817838 |
ttcgctctagctttaaacaggacccccgcaagtgggcggtggaattggtctcctcaaattaatcg |
43817774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 30879228 - 30879191
Alignment:
| Q |
174 |
gcaagtggacgatgggattggttccctcaaattaatcg |
211 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
30879228 |
gcaagtggacggtgggattggttccctcagattaatcg |
30879191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University