View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1169_low_82 (Length: 230)

Name: NF1169_low_82
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1169_low_82
NF1169_low_82
[»] chr1 (4 HSPs)
chr1 (7-230)||(14928499-14928723)
chr1 (142-194)||(37047095-37047147)
chr1 (150-201)||(12876971-12877022)
chr1 (156-213)||(30677293-30677350)
[»] chr3 (4 HSPs)
chr3 (150-213)||(51532900-51532963)
chr3 (150-207)||(33398497-33398554)
chr3 (141-217)||(40302665-40302741)
chr3 (144-214)||(10538148-10538218)
[»] scaffold0623 (1 HSPs)
scaffold0623 (150-207)||(1085-1142)
[»] scaffold0366 (1 HSPs)
scaffold0366 (150-207)||(9328-9385)
[»] chr6 (1 HSPs)
chr6 (156-217)||(17149475-17149536)
[»] scaffold0171 (1 HSPs)
scaffold0171 (142-217)||(11439-11514)
[»] chr5 (3 HSPs)
chr5 (142-201)||(19145447-19145505)
chr5 (148-217)||(4603886-4603955)
chr5 (150-195)||(9659352-9659397)
[»] chr2 (2 HSPs)
chr2 (186-221)||(31439410-31439445)
chr2 (171-211)||(41314123-41314163)
[»] chr8 (2 HSPs)
chr8 (150-207)||(42328119-42328176)
chr8 (147-211)||(43817774-43817838)
[»] chr4 (1 HSPs)
chr4 (174-211)||(30879191-30879228)


Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 7 - 230
Target Start/End: Complemental strand, 14928723 - 14928499
Alignment:
7 tcatcatctacaaatcacaaaataattagttagaacttagagataaatttcacannnnnnnngtcacaatcttatccttaaatttgtttctgttttcaat 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||    
14928723 tcatcatctacaaatcacaaaataattagttagaacttagagataaatttcacattttttttgtcacaatcttatccttaaatttgtttctgttttcaat 14928624  T
107 ttttattgcatattaatagtgcgctattttacattagagcttcgctctagctttaaatgagtc-ccccgcaagtggacgatgggattggttccctcaaat 205  Q
    ||| ||||||||||||||||| || ||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||||||||||||    
14928623 tttgattgcatattaatagtgtgcaattttacattagagcttcgctctggctttaaatgagtccccccgcaagtggacaatgggattggttccctcaaat 14928524  T
206 taatcggtccttagatataaaaatt 230  Q
    |||||||||||||||||||||||||    
14928523 taatcggtccttagatataaaaatt 14928499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 142 - 194
Target Start/End: Original strand, 37047095 - 37047147
Alignment:
142 agagcttcgctctagctttaaatgagtcccccgcaagtggacgatgggattgg 194  Q
    ||||||| |||||||||||||||| | ||||| |||||||||| |||||||||    
37047095 agagctttgctctagctttaaatggggcccccacaagtggacggtgggattgg 37047147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 150 - 201
Target Start/End: Complemental strand, 12877022 - 12876971
Alignment:
150 gctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctc 201  Q
    |||||||||||||| | | |||||||||||||||| |||||||||| |||||    
12877022 gctctagctttaaacggggcccccgcaagtggacggtgggattggtcccctc 12876971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 213
Target Start/End: Original strand, 30677293 - 30677350
Alignment:
156 gctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcggt 213  Q
    |||||||||| | ||||||||||||| || |||||||||| |||||| |||| |||||    
30677293 gctttaaatgggacccccgcaagtgggcggtgggattggtcccctcagattagtcggt 30677350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 213
Target Start/End: Original strand, 51532900 - 51532963
Alignment:
150 gctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcggt 213  Q
    |||||| ||||||||| | |||||||||||||||| |||||||||| |||||| |||| |||||    
51532900 gctctaactttaaatgggacccccgcaagtggacggtgggattggtcccctcagattagtcggt 51532963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 207
Target Start/End: Complemental strand, 33398554 - 33398497
Alignment:
150 gctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaatta 207  Q
    |||||||||||||| | | ||||||||||||| || |||||||||||||||| |||||    
33398554 gctctagctttaaacggggcccccgcaagtgggcggtgggattggttccctcgaatta 33398497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 141 - 217
Target Start/End: Complemental strand, 40302741 - 40302665
Alignment:
141 tagagcttcgctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcggtcctt 217  Q
    |||| ||| ||||| ||||||||||   ||||||||| |||||| |||||||||  ||||||||||| |||||||||    
40302741 tagatctttgctctggctttaaatgctccccccgcaattggacggtgggattggacccctcaaattagtcggtcctt 40302665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 144 - 214
Target Start/End: Complemental strand, 10538218 - 10538148
Alignment:
144 agcttcgctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcggtc 214  Q
    ||||| |||||||||||||||| | ||  |||||||||||  |||||||||  ||||||||||| ||||||    
10538218 agctttgctctagctttaaatgggacctacgcaagtggacagtgggattggacccctcaaattagtcggtc 10538148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0623 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0623
Description:

Target: scaffold0623; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 207
Target Start/End: Complemental strand, 1142 - 1085
Alignment:
150 gctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaatta 207  Q
    ||||| |||||||||| | |||||||||||||||| |||||||||| ||||| |||||    
1142 gctctggctttaaatggggcccccgcaagtggacggtgggattggtcccctcgaatta 1085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0366 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0366
Description:

Target: scaffold0366; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 150 - 207
Target Start/End: Complemental strand, 9385 - 9328
Alignment:
150 gctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaatta 207  Q
    ||||| |||||||||| | |||||||||||||||| |||||||||| ||||| |||||    
9385 gctctggctttaaatggggcccccgcaagtggacggtgggattggtcccctcgaatta 9328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 217
Target Start/End: Complemental strand, 17149536 - 17149475
Alignment:
156 gctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcggtcctt 217  Q
    |||||||||| | |||||||||||| ||| |||||||||| ||||| ||||| |||||||||    
17149536 gctttaaatggggcccccgcaagtgaacggtgggattggtcccctcgaattagtcggtcctt 17149475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0171 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0171
Description:

Target: scaffold0171; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 142 - 217
Target Start/End: Complemental strand, 11514 - 11439
Alignment:
142 agagcttcgctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcggtcctt 217  Q
    ||||||| || || |||||||||| |  ||||||||||||| |||||||||| | ||||||||||| | |||||||    
11514 agagctttgccctggctttaaatggggtccccgcaagtggaagatgggattgatcccctcaaattagttggtcctt 11439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 142 - 201
Target Start/End: Complemental strand, 19145505 - 19145447
Alignment:
142 agagcttcgctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctc 201  Q
    ||||||| ||||| |||||||||| ||||||||||||||| || |||||||||| |||||    
19145505 agagctttgctctggctttaaatg-gtcccccgcaagtgggcggtgggattggtcccctc 19145447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 217
Target Start/End: Original strand, 4603886 - 4603955
Alignment:
148 tcgctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcggtcctt 217  Q
    ||||||| |||||||| | | |||| ||||||||||| |||||||||| |||||  |||| |||||||||    
4603886 tcgctctggctttaaacggggcccctgcaagtggacggtgggattggtcccctcggattagtcggtcctt 4603955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 150 - 195
Target Start/End: Complemental strand, 9659397 - 9659352
Alignment:
150 gctctagctttaaatgagtcccccgcaagtggacgatgggattggt 195  Q
    ||||| |||||||||| | |||||||||||||||| ||||||||||    
9659397 gctctggctttaaatgggccccccgcaagtggacggtgggattggt 9659352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 186 - 221
Target Start/End: Complemental strand, 31439445 - 31439410
Alignment:
186 tgggattggttccctcaaattaatcggtccttagat 221  Q
    ||||||| ||||||||||||||||||||||||||||    
31439445 tgggatttgttccctcaaattaatcggtccttagat 31439410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 171 - 211
Target Start/End: Original strand, 41314123 - 41314163
Alignment:
171 cccgcaagtggacgatgggattggttccctcaaattaatcg 211  Q
    |||||||||||||| |||||||||| |||||| ||||||||    
41314123 cccgcaagtggacggtgggattggtcccctcagattaatcg 41314163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 150 - 207
Target Start/End: Original strand, 42328119 - 42328176
Alignment:
150 gctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaatta 207  Q
    ||||| |||||||| | | ||||| ||||||||||||||||||||| ||||| |||||    
42328119 gctctggctttaaacggggcccccacaagtggacgatgggattggtcccctcgaatta 42328176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 211
Target Start/End: Complemental strand, 43817838 - 43817774
Alignment:
147 ttcgctctagctttaaatgagtcccccgcaagtggacgatgggattggttccctcaaattaatcg 211  Q
    |||||||||||||||||   | ||||||||||||| || ||| ||||||  ||||||||||||||    
43817838 ttcgctctagctttaaacaggacccccgcaagtgggcggtggaattggtctcctcaaattaatcg 43817774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 30879228 - 30879191
Alignment:
174 gcaagtggacgatgggattggttccctcaaattaatcg 211  Q
    ||||||||||| ||||||||||||||||| ||||||||    
30879228 gcaagtggacggtgggattggttccctcagattaatcg 30879191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University