View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11700_high_13 (Length: 430)
Name: NF11700_high_13
Description: NF11700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11700_high_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 6e-38; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 318 - 415
Target Start/End: Original strand, 37259259 - 37259352
Alignment:
| Q |
318 |
cgtagtttataatgtgaaaatatatatggcataagatggaggaacgcgtggtgtgtagtgcgcatgcagtgtaaatgtgaatcaaaggtggcattgtt |
415 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37259259 |
cgtagtttataatgtgaaaatat----ggcataagatggaggaacgcgtggtgtgtagtgcgcatgcagtgtaaatgtgaatcaaaggtggcattgtt |
37259352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 179 - 256
Target Start/End: Original strand, 37259064 - 37259141
Alignment:
| Q |
179 |
gttttgttagtgtgattttcatgtcctatatcttttatgttatggcatcaaaaaatgaacattgtgttatatttgtgc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37259064 |
gttttgttagtgtgattttcatgtcctatatcttttgtgttatggcatcaaaaaatgaacattgtgttatatttgtgc |
37259141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 8 - 105
Target Start/End: Original strand, 37258893 - 37258990
Alignment:
| Q |
8 |
gacgttggatgtaggcttcataggatttgtaaccggatcgtattgttaggtcnnnnnnngatgtttttgatgttgttatggtattgatgggttgtgtg |
105 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37258893 |
gacgttggatgtaggcttcataggacttgtaaccgggtcgtattgttaggtctttttttgatgtttttgatgttgttgtggtattgatgggttgtgtg |
37258990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 255 - 284
Target Start/End: Original strand, 37259185 - 37259214
Alignment:
| Q |
255 |
gccatgaaaattctggagtgagatatgatt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37259185 |
gccatgaaaattctggagtgagatatgatt |
37259214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University