View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11700_high_34 (Length: 238)
Name: NF11700_high_34
Description: NF11700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11700_high_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 9847840 - 9848063
Alignment:
| Q |
1 |
ttaggccaatatgaaggattatatttggaaagagattggctgtatatgtagatggactttccattgtaggtatatttattaacatgggtgaacgtacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
9847840 |
ttaggccaatatgaaggattatatttggaaagagattggctgtatatgtagatggactttccattgtaggtacatttattaacatgggtcaacgtacaaa |
9847939 |
T |
 |
| Q |
101 |
ctatgttgtgacagcatattttactttctaattatcatagaagttataatatgtgtagtattatagaaaggttttatatatatgctgcatataatgtcga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9847940 |
ctatgttgtgacagcatattttactttctaattatcatagaagttataatatgtgt-gtattatagaaaggttttatatatatgctgcatataatgtcga |
9848038 |
T |
 |
| Q |
201 |
atggtgaggtgatatatcagaagtg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
9848039 |
atggtgaggtgatatatcagaagtg |
9848063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University