View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11700_low_30 (Length: 255)
Name: NF11700_low_30
Description: NF11700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11700_low_30 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 14 - 255
Target Start/End: Original strand, 9847583 - 9847824
Alignment:
| Q |
14 |
agagatacatggtttcatttaattgcttccattttctaaaattgttggtgtcagtgtcatgtcatgtgataatagtccttcatagatccttttatacttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9847583 |
agagatacatggtttcatttaattgcttccattttctaaaattgttggtgtcagtgtcatgtcatgtgataataatccttcatagatccttttatacttc |
9847682 |
T |
|
| Q |
114 |
agtaatttatttactgttatgattctataattcctaagtgggactagattaggctatgccattgttctgaaccaacatattgtgtaactcattattttgt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9847683 |
agtaatttatttactgttatgattctataattcctaagtaggactagattaggctatgccattgttctgaaccaacatattgtgtaactcattattttgt |
9847782 |
T |
|
| Q |
214 |
gctttctctattttgtctttgtgatagacataccctggaatt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9847783 |
gctttctctattttgtctttgtgatagacataccctggaatt |
9847824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University