View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11700_low_40 (Length: 240)
Name: NF11700_low_40
Description: NF11700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11700_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 45 - 224
Target Start/End: Complemental strand, 6876733 - 6876554
Alignment:
| Q |
45 |
ctctttatctttttcttattggaattgcgtagggaaatgggaatcggaaaacatgaacacttggatctctttaattaattgttaatattgttaaatgata |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6876733 |
ctctttatctttttcttattggaattgcgtagggaaatgggaattggaaaacatgaacacttggatctctttaattaattgttaatattgttaaatgata |
6876634 |
T |
 |
| Q |
145 |
aaattatatgtacatattactgttgatgaaatcatacgcgtcaatttgattactatatgtcataatgtcaacgttatagt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6876633 |
aaattatatgtacatattactgttgatgaagtcatacgcgtcaatttgattactatatgtcataatgtcaacgttatagt |
6876554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University