View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11700_low_40 (Length: 240)

Name: NF11700_low_40
Description: NF11700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11700_low_40
NF11700_low_40
[»] chr4 (1 HSPs)
chr4 (45-224)||(6876554-6876733)


Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 45 - 224
Target Start/End: Complemental strand, 6876733 - 6876554
Alignment:
45 ctctttatctttttcttattggaattgcgtagggaaatgggaatcggaaaacatgaacacttggatctctttaattaattgttaatattgttaaatgata 144  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6876733 ctctttatctttttcttattggaattgcgtagggaaatgggaattggaaaacatgaacacttggatctctttaattaattgttaatattgttaaatgata 6876634  T
145 aaattatatgtacatattactgttgatgaaatcatacgcgtcaatttgattactatatgtcataatgtcaacgttatagt 224  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
6876633 aaattatatgtacatattactgttgatgaagtcatacgcgtcaatttgattactatatgtcataatgtcaacgttatagt 6876554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University