View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11701_high_11 (Length: 443)
Name: NF11701_high_11
Description: NF11701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11701_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 9e-34; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 1105707 - 1105817
Alignment:
| Q |
1 |
atgttatgaaagatttacaagaatttcaaacccacatataaaggaaaatgcagggcactagttagcatgacaaataaaaaagtcaacctcaattcataga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | |||| ||| | |||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1105707 |
atgttatgaaagatttacaagaatttcaaacccacaca--aagggaaacgtggggcactagttaacatgacaaataaaaaagtcaaccacaattcataga |
1105804 |
T |
|
| Q |
101 |
gtatcatatgatt |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1105805 |
gtatcatatgatt |
1105817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 248 - 332
Target Start/End: Original strand, 1105906 - 1105990
Alignment:
| Q |
248 |
gaatattgcatgaatttttaaccattatatttaaagaaagttttttaagtcccttgattggtagacatgaatttctaaccacctt |
332 |
Q |
| |
|
||||||||||||||||||||||||| | ||| ||||||||||||| ||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
1105906 |
gaatattgcatgaatttttaaccatcagattaaaagaaagtttttcaagtcccatgattagtagacatgaatttctaaccacctt |
1105990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 391 - 425
Target Start/End: Original strand, 1106049 - 1106083
Alignment:
| Q |
391 |
tttatttgattaattattgatgagtggtcctcact |
425 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1106049 |
tttatttgattaattattgatgagtggtcctcact |
1106083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University