View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11701_high_31 (Length: 248)
Name: NF11701_high_31
Description: NF11701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11701_high_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 22666141 - 22666275
Alignment:
| Q |
1 |
gcgattctttgacatcagagagtcatgcatataaggtgttactgctgatgatgagtgggaaagggaggtaagttttgtttatttgatcagttttttagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22666141 |
gcgattctttgacatcagagagtcatgcatataaggtgttactgctgatgatgagtgggaaagggaggtaagttttgtttatttgatcag----ttagat |
22666236 |
T |
|
| Q |
101 |
tgagtttgcagtcaacaagactctagcttattctctctc |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22666237 |
tgagtttgcagtcaacaagactctagcttattctctctc |
22666275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 150 - 184
Target Start/End: Original strand, 22666291 - 22666325
Alignment:
| Q |
150 |
gactctagcttattttccctcaagagacagactca |
184 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22666291 |
gactctagcttattttccctcaagagatagactca |
22666325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University