View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11701_high_37 (Length: 229)
Name: NF11701_high_37
Description: NF11701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11701_high_37 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 22669599 - 22669377
Alignment:
| Q |
7 |
atttgcacttttaacattaggtggatttcttttaaacattgttgagtataacatcgcatttccgcctgtcnnnnnnngaagggaccatgatacttcttta |
106 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
22669599 |
atttgcactttgaacattaggtggatttcttttaaacattgttgagtataacatcgcatttccgcctgtctttttttgaagggaccatgatatttcttta |
22669500 |
T |
 |
| Q |
107 |
ccatgtcatgagcaaccatttttgctaagcttccatgttaacatgcagaccaagcaggccacataatgctcttcaaaaccttatatgttgtctaagatta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
22669499 |
ccatgtcatgagcaaccatttttgctaagcttccatgttaacatgcagaccaagcaggccacatactgcccttcaaaaccttatatgttgtctaagatta |
22669400 |
T |
 |
| Q |
207 |
ttgacaatttcaatatgcactat |
229 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
22669399 |
ttgacaacttcaatatgcactat |
22669377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University