View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11701_low_14 (Length: 404)
Name: NF11701_low_14
Description: NF11701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11701_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 19 - 382
Target Start/End: Complemental strand, 2465357 - 2464999
Alignment:
| Q |
19 |
gaaagcttctggatgattatattttagtttaggcaggaatatgcagtaaaatatctaaggtatagttctcattttagtaagtcgagcgcggctgtgacag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2465357 |
gaaagcttctggatgattatattttagtttaggcaggaatatgcagtaaaatatctaaggtatagttctcattttagtaagtcgagcgcggctgtgacag |
2465258 |
T |
|
| Q |
119 |
aggcataacatgatcttaaaaacatgaaaatggggttagttctgcttgtggacggcagctctaactaaaatgccgcatctccaatggatggtttaaactt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||| ||||||||| ||||||||||||||||| |||||| |||||||||||| |||||||||||| |
|
|
| T |
2465257 |
aggcataacatgatcttaaaaacatgaaaatgagcttaattctgcttgaggacggcagctctaactccaatgccacatctccaatgggtggtttaaactt |
2465158 |
T |
|
| Q |
219 |
gaagatatcattgtagcagagcaagcttgttagttgtgtccagacctggcgacagcctttatttgagtggtagtgttttagtgccactctagagtgtaaa |
318 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||||| |
|
|
| T |
2465157 |
gaagatatcattgtagcagggcaagcttgttagttgtgtccagacctggcgacagcctttatttgagtg-----gttttagtggcactctggagtgtaaa |
2465063 |
T |
|
| Q |
319 |
aattttctccattgatttcttctgttataaacacaacatctcaaacatcgttaaatgccctttt |
382 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2465062 |
aaatttctccattgatttcttctgttataaacacaacatctcaaacatcgttaaatgccctttt |
2464999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University