View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11701_low_36 (Length: 237)
Name: NF11701_low_36
Description: NF11701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11701_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 109 - 224
Target Start/End: Original strand, 44984097 - 44984212
Alignment:
| Q |
109 |
ctaatttggtggatcaaataattgtgtaagttaaaagcttcaattgaatnnnnnnnncggtaccttttcgaggtcatcttggatctcttgcaatttctcg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44984097 |
ctaatttggtggatcaaataattgtgtaagttaaaagcttcaattgaataaaaaaaacggtaccttttcgaggtcatcttggatctcttgcaatttctcg |
44984196 |
T |
 |
| Q |
209 |
atggagaggatgagtt |
224 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44984197 |
atggagaggatgagtt |
44984212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University