View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11702_high_16 (Length: 309)
Name: NF11702_high_16
Description: NF11702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11702_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 18 - 295
Target Start/End: Original strand, 40060627 - 40060901
Alignment:
| Q |
18 |
tttataatggattaacagttgggtaattactaaggtccagatgcatacaacatttaacacaaaacctatgtataatggactactacaaattaagaagggg |
117 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40060627 |
tttataatggatcaacagttgggtaa---ctaaggtctagatgcatacaacatttaacacaaaacctatgtataatggactactacaaattaagaagggg |
40060723 |
T |
 |
| Q |
118 |
gcaattacatgaattatattggaaggaacataattaaaggaagatttatttatgggagtgagggagtaattaagtgagttcaagttccaaattctgcaat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40060724 |
gcaattacatgaattatattggaaggaacataattaaaggaagatttatttatgggagtgagggactaattaagtgagttcaagttccaaattctgcaat |
40060823 |
T |
 |
| Q |
218 |
gctttgtaatgctggcctccattggccactaccaccaacaatatgtcttccaacacttctgttggtgcttctgctgcc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40060824 |
gctttgtaatgctggcctccattggccactaccaccaacaatatgtcttccaacacttctgttggtgcttctgctgcc |
40060901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University