View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11702_low_12 (Length: 360)
Name: NF11702_low_12
Description: NF11702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11702_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 22 - 350
Target Start/End: Original strand, 4845596 - 4845924
Alignment:
| Q |
22 |
gaacacaacctaactaaatgtaattaaacgtgtcggtgtcgtacacactgcattctaaaaaagtttatgagactttgaatttgaatgctgaaaaagtcta |
121 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4845596 |
gaacacaacacaactaaatgtaattaaacgtgtcggtgtcatacacgctgcattctaaaaaagtttatgagactttgaatttgaatgctgaaaaagtcta |
4845695 |
T |
|
| Q |
122 |
ttatttatgactgtgtaatgaagtacattgattggaaatgctatttattggaaggacttactaaatgtcccaagataaaggtccctatttccagctactc |
221 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4845696 |
ttatttatgactgtgtaatgaagtacacggattggaaatgctatttattggaaggacttactaaatgtcccaagataaaggtccctatttccagctactc |
4845795 |
T |
|
| Q |
222 |
tgcctatccttgcttgccatctaccatgctggtggtgtctgcataacatttaaaactaaagttagtacaaaatcattcttaaataatctatagaggaaaa |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4845796 |
tgcctatccttgcttgccatctaccatgctggtggtgtctgcataacatttaaaactaaagttagtacaaaatcattcttaaataatctatagaggaaaa |
4845895 |
T |
|
| Q |
322 |
tagacaaatatgaatcaaatgcaaaacct |
350 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4845896 |
tagacaaatatgaatcaaatgcaaaacct |
4845924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 209 - 264
Target Start/End: Original strand, 53234535 - 53234590
Alignment:
| Q |
209 |
tttccagctactctgcctatccttgcttgccatctaccatgctggtggtgtctgca |
264 |
Q |
| |
|
||||| || ||||||||||| ||||| ||||||| |||||||||||||||||||| |
|
|
| T |
53234535 |
tttccggcaactctgcctattcttgcctgccatcggccatgctggtggtgtctgca |
53234590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 207 - 255
Target Start/End: Original strand, 24562135 - 24562183
Alignment:
| Q |
207 |
tatttccagctactctgcctatccttgcttgccatctaccatgctggtg |
255 |
Q |
| |
|
||||||| || |||||||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
24562135 |
tatttcctgcaactctgccaatccttgcttgccatcttccatgttggtg |
24562183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University