View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11702_low_13 (Length: 359)
Name: NF11702_low_13
Description: NF11702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11702_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 6e-56; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 224 - 342
Target Start/End: Complemental strand, 31793126 - 31793008
Alignment:
| Q |
224 |
ttatacttaatttctgtttatgaatttcatgttcccataagaattcaagatttaaaccttagtgacatttcctgtgtataatagaaagaaaacaaagaaa |
323 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31793126 |
ttatacttaatttctgtttatgaatttcaggttcccataagaattcaatatttaaaccttagtgacatttcctgtgtataatagaaagaaaacaaagaaa |
31793027 |
T |
|
| Q |
324 |
aactatgacacctaaaatt |
342 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31793026 |
aactatgacacctaaaatt |
31793008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 73 - 139
Target Start/End: Complemental strand, 31793196 - 31793130
Alignment:
| Q |
73 |
ttataccgttaagtgatgagtaaaacccagtggattagttgcgaaaatcttttatgtagaatttaac |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31793196 |
ttataccgttaagtgatgagtaaaacccagtggattagttgcaaaaatcttttatgtagaatttaac |
31793130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 31793270 - 31793239
Alignment:
| Q |
1 |
tttatgatttgctatgatatacttgtaattga |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31793270 |
tttatgatttgctatgatatacttgtaattga |
31793239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University