View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11702_low_19 (Length: 252)
Name: NF11702_low_19
Description: NF11702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11702_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 53459228 - 53459466
Alignment:
| Q |
13 |
agatgaatacaattacaccaacttcatatgaaaatgcaattgtatgcatggagacaaaatatattcccaaaacagtagaagtactattgtgtgtgttatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53459228 |
agatgaatacaattacaccaacttcatatgaaaatgcaattgtatgcatggagacaaaatatattcccaaaacaatagaagtactattgtgtgtgttatg |
53459327 |
T |
 |
| Q |
113 |
tgcaatatctgtttctgtgggtgcaaattctttctctgcaatgtgtattttatgtgcatatt-gatcaacccatgcggtttctttaattatgtgattaaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53459328 |
tgcaatatctgtttctgtgggtgcaaattctttctctgcaatgtgtattttatgtgcatattggatcaacccatgcggtttctttaattatgtgattaaa |
53459427 |
T |
 |
| Q |
212 |
aatgatttgtagggataatcatgtgattcaataggccta |
250 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
53459428 |
aatgatttgtagggataatcctgtgactcaataggccta |
53459466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University