View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11702_low_20 (Length: 240)
Name: NF11702_low_20
Description: NF11702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11702_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 225
Target Start/End: Original strand, 39308512 - 39308721
Alignment:
| Q |
17 |
ttttgaaaatgtattgtacttttttcttcattggttgtactagctaggaccagatggggtgataaattgggagagagagcacgccaagcctataggcnnn |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39308512 |
ttttgaaaatgtattgtacttttttcttcattggttgtactagctaggaccagatggggtgataaattgggagagagagcacgccaagcctataggcttt |
39308611 |
T |
 |
| Q |
117 |
nnnn-ccctctcttctaatggaaaaaataagaattgtgttgtacctaataatacttacaatttccatttagtagtgtgtatggtttgaacattaattaca |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39308612 |
tttttccctctcttctaatggaaaaaataagaattgtgttgtacctaataatacttacaatttccatttagtagtgtgtatggtttgaacattaattaca |
39308711 |
T |
 |
| Q |
216 |
cttggattct |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
39308712 |
cttggattct |
39308721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University