View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11702_low_21 (Length: 239)
Name: NF11702_low_21
Description: NF11702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11702_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 25875082 - 25875267
Alignment:
| Q |
1 |
atcattaattaattgattaacataatagtactgtatatttaatggcgtttgttgagttgagtgtactatggaaagtatttgtcaactgtcatttagataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25875082 |
atcattaattaattgattaacataatagtactatatatttaatgccgtttgttgagttgagtgtactatggaaagtatttgtcaactgtcattttgataa |
25875181 |
T |
 |
| Q |
101 |
ttttttggttagaagaatttaaggcgaaggaatggcatgaaggttcgtagtctcgtagataaaaggatattaaaccatcaatgaaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
25875182 |
ttttttggttagaagaatttaaggcgaaggaatggcatgaaggttcgtagtctcgtagataaaatgatattaaactatcaatgaaa |
25875267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University