View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11702_low_23 (Length: 226)

Name: NF11702_low_23
Description: NF11702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11702_low_23
NF11702_low_23
[»] chr8 (1 HSPs)
chr8 (1-128)||(25874668-25874793)


Alignment Details
Target: chr8 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 25874668 - 25874793
Alignment:
1 gtagattcactaaaagggacaattgcaaccgacaagatgtttatacttattannnnnnnnaataaaacttgttgtttatctcgaatataactgaaagaaa 100  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||        |||||||||||||||| |||||||||||||||||||||||    
25874668 gtagattcacaaaaagggacaattgcaaccgacaagatgtttatacttattattttttt-aataaaacttgttgtt-atctcgaatataactgaaagaaa 25874765  T
101 tttatgtaagactaaaataaaatctatt 128  Q
    ||||||||||||||||||||||||||||    
25874766 tttatgtaagactaaaataaaatctatt 25874793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University