View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11703_high_58 (Length: 338)
Name: NF11703_high_58
Description: NF11703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11703_high_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 1e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 13 - 213
Target Start/End: Complemental strand, 31930330 - 31930141
Alignment:
| Q |
13 |
caaaggcaaattgctataataaggcattttcaaatccttttatgaaatgtcataacaaagtaatctatattgtttttagtgtgagcaagcaaaagatagg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31930330 |
caaaggcaaattgctataataaggcattttcaaatccttttatgaaatgtcataacaaagtaatctatattgtttttagtgtgagcaagcaaaagatagg |
31930231 |
T |
 |
| Q |
113 |
tgacgagaggaaaaggtgagaagtttaggtgaaagcttaatatgacaaatgacaatggtggattggtggtctagttgcttttgtattttttattggttga |
212 |
Q |
| |
|
|||||| ||||||||||||||| || |||| ||||||||||||||||||| |||||||| ||| ||||||||||||||||| ||||||||| |
|
|
| T |
31930230 |
tgacgaaaggaaaaggtgagaaattgaggt---agcttaatatgacaaatgagaatggtggtttg--------gttgcttttgtatttttcattggttga |
31930142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University