View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11703_high_83 (Length: 251)
Name: NF11703_high_83
Description: NF11703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11703_high_83 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 76 - 251
Target Start/End: Original strand, 36252418 - 36252593
Alignment:
| Q |
76 |
ccaagcatgctgcagtcttaccactgctgtccttgaagcttaatggtcccagttttctatttgaaacaaggatgaatgaaatgatgctctattggatata |
175 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36252418 |
ccaagtatgctgcagtcttaccactgctatccttgaagcttaatggtcccggttttctatttgaaacaaggatgaatgaaatgatgctctattggatata |
36252517 |
T |
 |
| Q |
176 |
ctgaacttgccggactgaaatatttttcttttaatttcatctactttgttccgtagtttctatctatacttgtgca |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
36252518 |
ctgaacttgccggactgaaatatttttcttttaatttcatctacgttgttccgcagtttctatctatacttgtgca |
36252593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University